site stats

Btbd35f23

WebMouse Btbd35f23 (Gene ID: 100861966) vectors (from $99), available in lentivirus, AAV, adenovirus, shRNA, CRISPR & many other formats from VectorBuilder. Mouse … WebENSMUSG00000064364 - ENSMUSG00000064363 ND4 ENSMUSG00000064351 COX1 ENSMUSG00000064349 - ENSMUSG00000032068 Plet1 ENSMUSG00000026034 Clk1 ENSMUSG00000061848 - ENSMUSG00000081827 -

Tbd 23 Acres County Road 3335, Cookville, TX 75558

WebMar 30, 2024 · The Frigidaire FGSC2335TF is a mid-range side-by-side refrigerator, which will sit flush with the rest of your countertop appliances, making it a great choice if you … WebBtbd35F23-KO Nomenclature C57BL/6JSmoc-Btbd35F23em1Smoc Cat. NO. TDB Strain State Developing Gene Summary Official Symbol Btbd35f23 Synonyms Gmcl2， Mgclh， Gmcl1l， Gm21950， Gmcl1p1， Btbd35f1 NCBI ID 100861966 MGI ID 5439401 Ensembl ID ENSMUSG00000100249 Human Ortholog BTBD35F23 Model Description cressing to london liverpool street https://stealthmanagement.net

Knockout All Project (KOAP) - GemPharmatech US

WebBtbd35f23 Name BTB domain containing 35, family member 23 Synonyms Gm21950 Feature Type protein coding gene IDs MGI:5439401 NCBI Gene: 100861966 Alliance … WebStandard name: MIR_466N_3P: Systematic name: MM2873: Brief description: Genes predicted to be targets of miRBase v22 microRNA mmu_miR_466n_3p in miRDB v6.0 with MirTarget v4 predi http://crispor.tefor.net/crispor.py?batchId=O7jGeia6p28FABQdZIgU&sortBy=fusi bucs super bowl parade

ChIP-Atlas: Target genes - biosciencedbc.jp

Category:CRISPOR

Tags:Btbd35f23

Btbd35f23

rnasensing.bio

WebPCR primers for off-targets of TGCAAGTGACTGCAGGGATA TGG. In the table below, Illumina Nextera Handle sequences have been added and highlighted in bold. WebGm21950 (untagged) - Mouse predicted gene, 21950 (Gm21950) The store will not work correctly in the case when cookies are disabled.

Btbd35f23

Did you know?

WebStandard name: MIR_6957_3P: Systematic name: MM2175: Brief description: Genes predicted to be targets of miRBase v22 microRNA mmu_miR_6957_3p in miRDB v6.0 with MirTarget v4 prediction scores > 80 (high confidence targets). WebHOMER motif enrichment analysis PHF6 ChIPseq annotated genes Consensus q-value (Benjamini) CCCCGCGC DHNDWATCGATD CKGAWWTTCHGS NYWACTTTTT DTHACTTTTT WHWHHACTTTTT

WebBtbd35f23 Mouse Gene Details BTB domain containing 35, family member 23 International Mouse Phenotyping Consortium. Phenotype data for mouse gene … http://www.informatics.jax.org/sequence/100861966

WebYour input sequence is 657 bp long. It contains 78 possible guide sequences. Shown below are their PAM sites and the expected cleavage position located -3bp 5' of the PAM site.

WebBtbd35f23 BTB domain containing 35, family member 23 [ (house mouse)] Gene ID: 100861966, updated on 25-Jan-2024 Summary Other designations mouse germ cell-less …

http://crispor.tefor.net/crispor.py?batchId=oluIi1ZRnOJmOEgIeD4n&pamId=s135-&otPrimers=1 cressing to liverpool streetWebEffector differentiation downstream of lineage commitment in ILC1 is driven by Hobit across tissues Friedrich et al., Nature Immunology (DOI: 10.1038/s41590-021-0101-0) cressing train stationWebFeb 15, 2024 · Gene Summary germ cell-less ( gcl) encodes a conserved BTB (broad-complex, tramtrack, and bric-a-brac) protein that mediates transcriptional repression in … bucs super rugby regulationsWeb南模生物. Language: English . 中文; 日本語; 한국어; Settings; Exit; Sign in cressing ukhttp://rnasensing.bio/pregenerated/mouse cressing united fcWebUCSC Mouse Gene Sorter : genome . assembly . search cressing weatherWebMouse Btbd35f23 (NM_001270667) cDNA/ORF clone Catalog Number: 717852-1 1 / 2 General Information Gene Name: BTB domain containing 35, family member 23 Official Symbol: Btbd35f23 Organism: Mus musculus RefSeq: NM_001270667 Description Sequence Description: Identical with the Gene Bank Ref. ID sequence. Vector: … cressing village